Recent public codes are listed below. You can filter them by the following programming languages:
- view
- All
- Ada
- Assembler
- Assembler
- AWK (gawk)
- AWK (mawk)
- Bash
- bc
- Brainf**k
- C
- C#
- C++
- C++0x
- C99 strict
- CLIPS
- Clojure
- COBOL
- COBOL 85
- Common Lisp (clisp)
- D (dmd)
- Erlang
- F#
- Factor
- Falcon
- Forth
- Fortran
- Go
- Groovy
- Haskell
- Icon
- Intercal
- Java
- JavaScript (rhino)
- JavaScript (spidermonkey)
- Lua
- Nemerle
- Nice
- Nimrod
- Objective-C
- Ocaml
- Oz
- Pascal (fpc)
- Pascal (gpc)
- Perl
- Perl 6
- PHP
- Pike
- Prolog (gnu)
- Prolog (swi)
- Python
- Python 3
- R
- Ruby
- Scala
- Scheme (guile)
- Smalltalk
- SQL
- Tcl
- Text
- Unlambda
- VB.NET
- Whitespace
-
1
help(file)
-
1
class(file)
-
1 2 3 4 5 6
ptask<-function(string) { charvec<-s2c(string) return nchar(charvec) } ptask("ATGATGATAGATGATGATCGACTGATCGATCGCATGTCGATGAC")
-
1 2 3 4
add<-function(a, b) { return (a+b) } add(5,6)
-
1 2 3 4
add<-function(a, b) { + return(a+b) } add(123,123)
-
1 2 3
add<-function(a, b) { + return(a+b) }
-
1 2 3
x<-"asdfasdf" length(x) nchar(x)
-
1 2
x<-c(1,2,3,4,5) sum(x)
-
1
letters[c(1,2,3,4,5)]
-
1 2
abc = c("O", "G") abc
-
1 2 3 4 5 6 7 8 9
<?xml version="1.0" ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"><head> <title>Geocache GC... Für Informatiker - 2</title> </head>
...
-
1 2 3 4 5 6 7 8 9
song<-function(n=99) { a<-" bottle" b<-" of beer on the wall, " c<-" of beer. " d<-"Take one down and pass it around: " # ## set "beer counter" vector counter<-c(as.character(n:1),"No more") #
...
-
1 2 3 4 5 6 7 8 9
song<-function(n=99) { a<-" bottle" b<-" of beer on the wall, " c<-" of beer. " d<-"Take one down and pass it around: " # ## set "beer counter" vector counter<-c(as.character(n:1),"No more") #
...
-
1 2 3 4
for (kIndex in 0:100000){ temp.value <- 2^(kIndex) print(temp.value) }
-
1 2 3 4 5 6 7 8 9
begin 644 webutils_pl M8F5G:6X@-C0T(&EN9F\R+FAT;6P-"DTO(UU8.S900#U&-5(\5D5/.T-40BPR M6%`H0F!?+T)@0")#4$$Q)%TC-25%,#$R(4@])E5,*"4A-3!$42D-"DTP4F!" M*S)<3S53+2,K4ETD-20P0#8D030S-%!`+#)84"@E,5(X-EE3.C<Q23M664$[ M(EQ/,3180B)"8$(-"DTZ)S%4/"-(3RM7/5<]4EE7+%)93SQ&/$\U)2A//B9! M5#LV4%$K5#$T,2)=6#HG,4T[(R1-/2<I03M'+4D-"DT])D5/.T8E3"M&,50Y M(BA>(D!(0"@B8"DH8$1`(D)@0"A@1$`H8$0I(C!(7#HG,4T[(B%8.S913CQ3 M5$(-"DTZ)S%4/"-(3RM7/5<]4EE7+%)93SQ&/$\L,T19+C)=6#HG,4T[(BA> M+R9!13@V,%XH(F!`(C!$*2@B8"D-"DTB0U%4.C<Q3#DS62<Y-EU#.#8M2#DR
...
-
1 2 3 4 5 6 7 8 9
song<-function(n=99) { a<-" bottle" b<-" of beer on the wall, " c<-" of beer. " d<-"Take one down and pass it around: " # ## set "beer counter" vector counter<-c(as.character(n:1),"No more") #
...
-
1 2 3 4 5 6 7 8 9
song<-function(n=99) { a<-" bottle" b<-" of beer on the wall, " c<-" of beer. " d<-"Take one down and pass it around: " # ## set "beer counter" vector counter<-c(as.character(n:1),"No more") #
...
-
1 2 3 4 5 6 7 8 9
song<-function(n=99) { a<-" bottle" b<-" of beer on the wall, " c<-" of beer. " d<-"Take one down and pass it around: " # ## set "beer counter" vector counter<-c(as.character(n:1),"No more") #
...
-
1 2 3 4 5 6 7 8 9
> #you will get a warning if there is more than one neighbor with the minimum distance > #but we will ignore that for now > > # plot these on the map: > plot( y ~ x) > for (i in 1:195) lines( c( x[i], x[nn[i]] ), c( y[i], y[nn[i]] ) ) #add lines to connect nearest neighbors > r <- numeric( 195 ) #create vectors with length of 100, that we will fill in with information nn <- numeric( 195 )
...
-
1 2 3 4 5 6 7 8 9
nloadRegister(function (){Quickling.init("452359;0", 10, {"prefetch_logging":false});}); onloadRegister(function (){window.intl_locale_rewrites = {"meta":{"\/_B\/":"^(.*[.,!?\\s]|)","\/_E\/":"([.,!?\\s].*|)$"},"patterns":{"\/\u0001(.*)('|')s\u0001(?:'|')s(.*)\/":"\u0001$1$2s\u0001$3","\/_\u0001([^\u0001]*)\u0001\/e":"mb_strtolower(\"\u0001$1\u0001\")","\/_\u0001([^\u0001]*)\u0001\/":"javascript"}};}); onloadRegister(function (){DocumentTitle.set("Facebook");}); onloadRegister(function (){JSCC.get('j4e8ac50018dc329714131771').init($("contentArea"), $('rightCol'), null, $('toolbarContainer'));}); onloadRegister(function (){JSCC.get('j4e8ac50018dc329714131773').getData().onLoad(false, true);}); onloadRegister(function (){new CounterDisplay("messages_unread", $("jewelInnerInboxCount"), $("jewelOuterInboxCount"), "fbMessagesItemList", "jewelUnread", true);}); onloadRegister(function (){window.presenceRequests = new RequestsJewel().init(JSCC.get('j4e8ac50018dc329714131774'), "[fb]requests", false)}); onloadRegister(function (){JSCC.get('j4e8ac50018dc329714131774').init("requests", $("fbRequestsJewel"));}); onloadRegister(function (){new MessagesJewel().init(JSCC.get('j4e8ac50018dc329714131775'), "[fb]messages")});
...
-
1 2
y=c(1:10) print (y)
-
1 2
y=c(1:10) echo y
-
1
y=c(1:10)
-
1 2
x=c(1,2,4,8,16 ) max(x)
-
1 2 3 4 5 6 7 8 9
song<-function(n=99) { a<-" bottle" b<-" of beer on the wall, " c<-" of beer. " d<-"Take one down and pass it around: " # ## set "beer counter" vector counter<-c(as.character(n:1),"No more") #
...
-
1 2 3
#!/bin/env Rscript watashi.Syusyoku<-function()"サクラチル" watashi.Syusyoku();
-
1 2 3 4 5 6 7 8 9
data1 = c(-10,1,1,1,-1,-1,-1,10) data2 = c(-10,-9,1,1,-1,-1,9,10) data3 = c(-10,10,-9,9,8,-8,7,-7) mean(data1) mean(data2) mean(data3) sd(data1)^2 sd(data2)^2 sd(data3)^2
-
1 2 3 4 5 6 7 8 9
data1 = -10:9 data2 = -10:11 data3 = 2*(-5:6) mean(data1) mean(data2) mean(data3) sd(data1) sd(data2) sd(data3)
-
1
data = -10:9
-
1
data = c(-10,-9,...,8,9)